NOTC1_DANRE

Ensembl ID:
ENSDARG00000044841
Description:
Neurogenic locus notch homolog protein 1 [Source:UniProtKB/Swiss-Prot;Acc:P46530]
Human Orthologue:
NOTCH1
Human Description:
notch 1 [Source:HGNC Symbol;Acc:7881]
Mouse Orthologue:
Notch1
Mouse Description:
Notch gene homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97363]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43576 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39316 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046633 Essential Splice Site 1003 1655 14 20
ENSDART00000122949   None 298 None 6
ENSDART00000129224   None 422 None 9
Genomic Location (Zv9):
Chromosome 21 (position 5073334)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4613026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAAAGAAGAGGAGAGAACCAGTGGGAGAGGACTCTGTCGGACTCAAG[T/G]CAGTTTCCACACACTTGCATGAGAGCTCTATATATTAATGCCATATATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046633 Essential Splice Site 1003 1655 15 20
ENSDART00000122949   None 298 None 6
ENSDART00000129224   None 422 None 9
Genomic Location (Zv9):
Chromosome 21 (position 5074078)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4612282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCTTTTATTACATGTAATGATGCTAACCTGTGACTCTGTGTTCCATC[A/G]GGCCTTTGAAAAACTCAGACAGCTCTCTGATGGATGAACAGCTGAGCGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link