cdk9

Ensembl ID:
ENSDARG00000044811
ZFIN ID:
ZDB-GENE-030131-321
Description:
cell division protein kinase 9 [Source:RefSeq peptide;Acc:NP_997756]
Human Orthologue:
CDK9
Human Description:
cyclin-dependent kinase 9 [Source:HGNC Symbol;Acc:1780]
Mouse Orthologue:
Cdk9
Mouse Description:
cyclin-dependent kinase 9 (CDC2-related kinase) Gene [Source:MGI Symbol;Acc:MGI:1328368]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14013 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065859 Essential Splice Site 79 393 3 8
Genomic Location:
Chromosome 21 (position 6060281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGAAAGTGGCCTTGAAGAAAGTTCTGATGGAGAATGAGAAAGAAGGGG[T/C]AAGAAAATGCAYCTCTATAATCTATTAAGTAAGGCAAGGCAAGTTTRTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ky6lvs70