fpgs

Ensembl ID:
ENSDARG00000044809
ZFIN ID:
ZDB-GENE-040426-2781
Description:
folylpolyglutamate synthase, mitochondrial [Source:RefSeq peptide;Acc:NP_998602]
Human Orthologue:
FPGS
Human Description:
folylpolyglutamate synthase [Source:HGNC Symbol;Acc:3824]
Mouse Orthologue:
Fpgs
Mouse Description:
folylpolyglutamyl synthetase Gene [Source:MGI Symbol;Acc:MGI:95576]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13906 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065858 Nonsense 160 572 5 16
ENSDART00000141607 Nonsense 160 572 5 15

The following transcripts of ENSDARG00000044809 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 6040818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATCAACGGTCAGCCAATAGGAAAAGAGCTTTTCACCAAATACTTCTGG[C/T]AAGTGTATGGACGACTGGAGGAGACAAAGGTGAGATGTTGTTTTGTAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/178ltj4g