LOC100333321

Ensembl ID:
ENSDARG00000044804
Human Orthologue:
PRODH
Human Description:
proline dehydrogenase (oxidase) 1 [Source:HGNC Symbol;Acc:9453]
Mouse Orthologue:
Prodh
Mouse Description:
proline dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:97770]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3115 Nonsense Available for shipment Available now
sa14001 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091331 Nonsense 186 385 3 9
Genomic Location:
Chromosome 21 (position 5719107)
KASP Assay ID:
554-2735.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTGTTTTCGGCTTGTTTTTCAGCTCCTGTGWTTCTGAGGCTGAGAAA[G/T]AGAGCCACGGTAAGTACAGTGAATTGGTGCAAAAATAAMTTTACAAAAGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14001
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091331 Nonsense 216 385 4 9
Genomic Location:
Chromosome 21 (position 5713030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCGTCAGTTTGGAGACCGGCGTGGAGGAGTGATCAGCGCTCGCACGTA[T/G]TTCTACGCAGATGAAGCCAAGTGTGACYATCACATGGAGAYCTTYATAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zb1zl233