dhrs3b

Ensembl ID:
ENSDARG00000044803
ZFIN ID:
ZDB-GENE-041010-172
Description:
dehydrogenase/reductase (SDR family) member 3b [Source:RefSeq peptide;Acc:NP_001006070]
Human Orthologue:
DHRS3
Human Description:
dehydrogenase/reductase (SDR family) member 3 [Source:HGNC Symbol;Acc:17693]
Mouse Orthologue:
Dhrs3
Mouse Description:
dehydrogenase/reductase (SDR family) member 3 Gene [Source:MGI Symbol;Acc:MGI:1315215]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14805 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14805
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065853 Nonsense 106 302 2 6

The following transcripts of ENSDARG00000044803 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 29474320)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 28350306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGYCATTATTTCGTTTGCGATGTGGCCAACAGGGAAGAAGTCTACAAG[C/T]AAGCCAAGGTTGTCAGAGAAAAGGTACAATATGCACCATAATATCATACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link