aadacl4

Ensembl ID:
ENSDARG00000044802
ZFIN ID:
ZDB-GENE-080919-2
Description:
arylacetamide deacetylase-like 4 [Source:RefSeq peptide;Acc:NP_001166113]
Human Orthologues:
AADACL3, AADACL4
Human Descriptions:
arylacetamide deacetylase-like 3 [Source:HGNC Symbol;Acc:32037]
arylacetamide deacetylase-like 4 [Source:HGNC Symbol;Acc:32038]
Mouse Orthologues:
9430007A20Rik, Aadacl3, Gm13124, Gm13177, Gm13178, Gm436, Gm438
Mouse Descriptions:
arylacetamide deacetylase-like 3 Gene [Source:MGI Symbol;Acc:MGI:2685281]
predicted gene 13124 Gene [Source:MGI Symbol;Acc:MGI:3652194]
predicted gene 13177 Gene [Source:MGI Symbol;Acc:MGI:3650257]
predicted gene 13178 Gene [Source:MGI Symbol;Acc:MGI:3650721]
predicted gene 436 Gene [Source:MGI Symbol;Acc:MGI:2685282]
predicted gene 438 Gene [Source:MGI Symbol;Acc:MGI:2685284]
RIKEN cDNA 9430007A20 gene Gene [Source:MGI Symbol;Acc:MGI:2685880]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15057 Essential Splice Site Available for shipment Available now
sa14153 Nonsense Available for shipment Available now
sa13637 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15057
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065851 Essential Splice Site 139 420 3 4
Genomic Location:
Chromosome 11 (position 29495398)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KTGAACCACTTTTCCATTGAWAYTTAACACRTCTNNNTTGTCTCTTCCTCCGY[A/T]GATGATTACGATGAAGTGTGTCAGCAWATRTCACTGAAGAGTRAYACSAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065851 Nonsense 372 420 4 4
ENSDART00000065851 Nonsense 372 420 4 4
Genomic Location:
Chromosome 11 (position 29496189)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCTGTGAGTTTGATGTGCTKAGAGATGAYGGCTTTCTGTRCCAGAAG[C/T]GACTGAGGGATTTAGGAGTGGACGTCACATGGGARCACCTACCTGAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065851 Nonsense 372 420 4 4
ENSDART00000065851 Nonsense 372 420 4 4
Genomic Location:
Chromosome 11 (position 29496189)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCTGTGAGTTTGATGTGCTKAGAGATGAYGGCTTTCTGTRCCAGAAG[C/T]GACTGAGGGATTTAGGAGTGGACGTCACATGGGARCACCTACCTGAGGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6pckr3fg