ENSDARG00000044796

Ensembl ID:
ENSDARG00000044796
Human Orthologues:
SAMD9, SAMD9L
Human Descriptions:
sterile alpha motif domain containing 9 [Source:HGNC Symbol;Acc:1348]
sterile alpha motif domain containing 9-like [Source:HGNC Symbol;Acc:1349]
Mouse Orthologue:
Samd9l
Mouse Description:
sterile alpha motif domain containing 9-like Gene [Source:MGI Symbol;Acc:MGI:1343184]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3332 Nonsense F2 line generated During 2014
sa8300 Nonsense Mutation detected in F1 DNA During 2014
sa12252 Nonsense Available for shipment Available now
sa18902 Nonsense Mutation detected in F1 DNA During 2014
sa16173 Nonsense Available for shipment Available now
sa21162 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3332
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065841 Nonsense 95 1636 2 13
Genomic Location:
Chromosome 7 (position 76802470)
KASP Assay ID:
554-2674.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTATTGGTCAGAGAAAGAAGACCGASCATTTGTCAAACGGAATGGCTA[C/A]MACAGTTTGGTAGAGTTAATCAACAAAAACAAAAGGAAAATATGGAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065841 Nonsense 351 1636 2 13
Genomic Location:
Chromosome 7 (position 76803238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGAGAGTGAGTTTCTTAAAGGGGGTCAACCTCAATGGRGGGACTTTTA[C/A]AGCTCAGAGCATCAAGGCACCTTGTTTGTCAAAAGAGACCTCTATGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12252
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065841 Nonsense 1101 1636 2 13
Genomic Location:
Chromosome 7 (position 76805486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGAAGAAGCCCGGAGTTTTATCTGTTGGTCCTTTTGTTGTTTTGGCCT[G/T]GAGATGATCAACAGAGTACACCAAACTCRCCAAACCTWGCAGAGTGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065841 Nonsense 1200 1636 2 13
Genomic Location:
Chromosome 7 (position 76805783)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGGTTAGAGACCACAAGGTGTTTGCTCTGAGGGGAACAGTCCAGATT[G/T]AAGTAACTCCTCACCATCCAGCCAGCGTACGTGGCCAAAGCCTTGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065841 Nonsense 1444 1636 7 13
Genomic Location:
Chromosome 7 (position 76808805)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCTATTTTAAAGCCSGGACCGGAATGYTCGCTTCAGATGAAGACTTG[G/A]TTTTTAATGYGGACGCTGGAGAAAATGAGGAAATCTGCTTGTCATTCTGR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21162
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065841 Nonsense 1539 1636 11 13
Genomic Location:
Chromosome 7 (position 76811571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTATGTGTTTGTTTGTTTGCAGATGAAAGCAGAGATTTCCCCAGTT[C/A]AAGCGGTAGGTCTCTAGCACTTATTCACAACAAAAGACTTCGTCTTGGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/45cogmj2