entpd2b

Ensembl ID:
ENSDARG00000044795
ZFIN ID:
ZDB-GENE-061013-2
Human Orthologue:
ENTPD2
Human Description:
ectonucleoside triphosphate diphosphohydrolase 2 [Source:HGNC Symbol;Acc:3364]
Mouse Orthologue:
Entpd2
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 2 Gene [Source:MGI Symbol;Acc:MGI:1096863]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23867 Nonsense Mutation detected in F1 DNA During 2014
sa9390 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065838 Nonsense 296 504 6 9
ENSDART00000134620 Nonsense 305 377 6 9
Genomic Location:
Chromosome 21 (position 9941204)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCTTCAGACTGAAGGAAGTGTTTGACTCGCCTTGCACGGCGTCATGG[A/T]GACCCAAACCTTACAACCCTCATTCCCACATCACAGTGCAAGGCACCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065838 Essential Splice Site 350 504 6 9
ENSDART00000134620 Essential Splice Site 359 377 6 9
Genomic Location:
Chromosome 21 (position 9941370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGCYTTTAATGGAGTTTTCCAGCCAAACATCAGTGGAGGCTTCATGG[T/G]GAGGGGCATWCAAACAGCCTTAATCGACTTGAAYAGAACACAATGTAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/75oazfsi