bace2l

Ensembl ID:
ENSDARG00000044781
ZFIN ID:
ZDB-GENE-041010-68
Description:
beta-secretase 2 [Source:RefSeq peptide;Acc:NP_001005991]
Human Orthologue:
BACE2
Human Description:
beta-site APP-cleaving enzyme 2 [Source:HGNC Symbol;Acc:934]
Mouse Orthologue:
Bace2
Mouse Description:
beta-site APP-cleaving enzyme 2 Gene [Source:MGI Symbol;Acc:MGI:1860440]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu3332 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065824 Nonsense 57 239 1 4
Genomic Location:
Chromosome 15 (position 6349068)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTTGCAAAAGAATGAAGCCGCTGCTAAAAGTGGACTGTCCCTGGCGT[C/A]AGATCCAGCGGGGATTGTTAACTTTCTAGACATGATTAATAATTTAAAAG
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control; 72 hpf

Control; 72 hpf

zoom

Mutant; 72 hpf

Mutant; 72 hpf

zoom

Control; 72 hpf

Control; 72 hpf

zoom

Mutant; 72 hpf

Mutant; 72 hpf

zoom

Stage Entity Quality Tag
Larval:Protruding-mouth
ZFS:0000035
melanocyte
ZFA:0009091
quality
PATO:0000001
abnormal
PATO:0000460
Adult
ZFS:0000044
whole organism
ZFA:0001094
viable
PATO:0000719
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zwcy3rf4