fut7

Ensembl ID:
ENSDARG00000044775
ZFIN ID:
ZDB-GENE-060929-997
Description:
alpha-1,3-fucosyltransferase [Source:RefSeq peptide;Acc:NP_001032467]
Human Orthologue:
FUT7
Human Description:
fucosyltransferase 7 (alpha (1,3) fucosyltransferase) [Source:HGNC Symbol;Acc:4018]
Mouse Orthologue:
Fut7
Mouse Description:
fucosyltransferase 7 Gene [Source:MGI Symbol;Acc:MGI:107692]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23885 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065818 Nonsense 89 352 2 2
Genomic Location:
Chromosome 21 (position 11882616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTGTGTCTGAGGGACTACAACATCTCTGGATGCATATTAGTGGACAAT[C/T]AAACTCTATATGAGAGCGCTGATCTGGTGGTCTTTCATAATTTTGAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/icvm3g97