pou5f1

Ensembl ID:
ENSDARG00000044774
ZFIN ID:
ZDB-GENE-980526-485
Description:
POU domain, class 5, transcription factor 1 [Source:UniProtKB/Swiss-Prot;Acc:Q90270]
Human Orthologues:
POU5F1, POU5F1B
Human Descriptions:
POU class 5 homeobox 1 [Source:HGNC Symbol;Acc:9221]
POU class 5 homeobox 1B [Source:HGNC Symbol;Acc:9223]
Mouse Orthologue:
Pou5f1
Mouse Description:
POU domain, class 5, transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:101893]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1329 Nonsense Available for shipment Available now
sa1294 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065817 Nonsense 16 472 1 5
Genomic Location (Zv9):
Chromosome 21 (position 11892529)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13593703
KASP Assay ID:
554-1243.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATGACGGAGAGAGCGCAGAGCCCAACAGCAGCAGACTGCAGACCCTA[T/A]GAGGTCAACAGGGCCATGTATCCTCAAGCCGCGGGCCTGGATGGACTTGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1294
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065817 Nonsense 367 472 4 5
Genomic Location (Zv9):
Chromosome 21 (position 11889172)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13590346
KASP Assay ID:
554-1209.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAGGCACAGTSCGTTCTGCTCTAGAGTCGTACTTCGTGAAGTGCCCC[A/T]AACCCAACACTCTGGAGATAACGCACATATCCGATGATCTAGGCCTGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link