kctd13

Ensembl ID:
ENSDARG00000044769
ZFIN ID:
ZDB-GENE-060825-162
Description:
BTB/POZ domain-containing protein KCTD13 [Source:RefSeq peptide;Acc:NP_001070619]
Human Orthologue:
KCTD13
Human Description:
potassium channel tetramerisation domain containing 13 [Source:HGNC Symbol;Acc:22234]
Mouse Orthologue:
Kctd13
Mouse Description:
potassium channel tetramerisation domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:1923739]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16855 Essential Splice Site Available for shipment Available now
sa26011 Nonsense Mutation detected in F1 DNA During 2015
sa13226 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16855
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065807 Essential Splice Site None 330 1 7
Genomic Location:
Chromosome 3 (position 14832100)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGAGAACTTAATATTTGATGCACCTTATCGCGGTGGTGACCCAGCTCGG[T/G]AAGTGTTTTCCTCGTTGACAGCCAYTCTAATGACATCTCGAGCTAGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065807 Nonsense 85 330 3 7
Genomic Location:
Chromosome 3 (position 14826402)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGCACATTTAAACATGTGTCCATTTGTATTGAAGGCTGGGTGGTGT[T/A]GGACCGATGCGGGAGACACTTTTCCCTGGTGTTGAACTTCCTGCGGGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065807 Nonsense 146 330 4 7
Genomic Location:
Chromosome 3 (position 14823002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCCTGTKTAATGTTGATGCAGAAACGCAGAGATGTTTGCAGAGGTTG[T/A]CACATTCCTATGATAACTTCAGCCAAAGAGGAACAGAGGATGATAGCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4ev63k2s