mitd1

Ensembl ID:
ENSDARG00000044766
ZFIN ID:
ZDB-GENE-040426-923
Description:
MIT domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_956495]
Human Orthologue:
MITD1
Human Description:
MIT, microtubule interacting and transport, domain containing 1 [Source:HGNC Symbol;Acc:25207]
Mouse Orthologue:
Mitd1
Mouse Description:
MIT, microtubule interacting and transport, domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41353 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065803 Nonsense 52 190 3 8
ENSDART00000128352 Nonsense 108 246 3 7
Genomic Location (Zv9):
Chromosome 9 (position 7324580)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7304673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGCAGACAGCTCCACTGGTTACAGCTATGAATCCCTCTTCAAGCCGTA[C/A]ATCACAGATGGACTGACTGAAGTCTGGGTGGAAGACCCATATGTACGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link