idh3b

Ensembl ID:
ENSDARG00000044753
ZFIN ID:
ZDB-GENE-040625-174
Description:
isocitrate dehydrogenase [Source:RefSeq peptide;Acc:NP_001002157]
Human Orthologue:
IDH3B
Human Description:
isocitrate dehydrogenase 3 (NAD+) beta [Source:HGNC Symbol;Acc:5385]
Mouse Orthologue:
Idh3b
Mouse Description:
isocitrate dehydrogenase 3 (NAD+) beta Gene [Source:MGI Symbol;Acc:MGI:2158650]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43610 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065777 Essential Splice Site 72 382 2 11
Genomic Location (Zv9):
Chromosome 21 (position 13939124)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15640079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGGAGTTGGACCGGAGCTGATGACTGCAGTCAAAGAGGTTTTCAAG[G/A]TACTGATTATTAGACATGAAGAAATCCTAAAATGTCTCTAGGACTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link