or137-2

Ensembl ID:
ENSDARG00000044704
ZFIN ID:
ZDB-GENE-070806-31
Description:
odorant receptor, family H, subfamily 137, member 2 [Source:RefSeq peptide;Acc:NP_001121859]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33973 Nonsense Mutation detected in F1 DNA During 2017
sa7052 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065693 Nonsense 16 314 1 1
Genomic Location (Zv9):
Chromosome 6 (position 52876979)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52925984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAATGACCGCAACGAACTCTACAAGGTTTCTATATAGTCTACAAGAG[C/T]AATATTCAGATTCGTTTGCAAAAAATTTTACAGTTGTCCTTCTTGCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065693 Nonsense 270 314 1 1
Genomic Location (Zv9):
Chromosome 6 (position 52877743)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52926748
KASP Assay ID:
554-5377.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTCCCACTTTCACCTATAGAYCGAGCAAGACTAACCTTTTTAAATTA[T/A]CTTCTTACCAATATATTACCACGATTGCTTACTCCCCTGATTTATGGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link