si:ch211-147j13.3

Ensembl ID:
ENSDARG00000044694
ZFIN ID:
ZDB-GENE-091204-85
Human Orthologue:
FYB
Human Description:
FYN binding protein [Source:HGNC Symbol;Acc:4036]
Mouse Orthologue:
Fyb
Mouse Description:
FYN binding protein Gene [Source:MGI Symbol;Acc:MGI:1346327]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23904 Nonsense Available for shipment Available now
sa15816 Essential Splice Site Available for shipment Available now
sa37279 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065674 Nonsense 426 747 6 18
ENSDART00000147010   None 264 None 11

The following transcripts of ENSDARG00000044694 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 18686334)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19821823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCAGGTCATCAGCAGCAGAGCCAAGTCAACCTCAAAAGAAACCGGAA[A/T]AAGATGTTAAAAACCAAAAAGACCGTGAGAAGAAAGAGAAAGACGCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065674 Essential Splice Site 447 747 7 18
ENSDART00000147010   None 264 None 11

The following transcripts of ENSDARG00000044694 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 18686482)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19821971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTTCACTAGYGATTTTAAACTGTTATCTTGCTAATGTGTTCTTTTCTC[A/T]GATAACACCRCCATTTCAGGTTATGCWTCAGGTAAAAGCAAAGTCTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065674 Nonsense 744 747 18 18
ENSDART00000147010 Nonsense 261 264 11 11

The following transcripts of ENSDARG00000044694 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 18693488)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19828977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACAGGTAACCAGTTCTTCTTTAAAATCTCCTTTACAGACTGTATTTA[T/G]GACAACGACTGAAGCTCTGCCACCGTCTTCTTCTCATCTTCAGGTGCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link