eri1

Ensembl ID:
ENSDARG00000044692
ZFIN ID:
ZDB-GENE-050522-39
Description:
3'-5' exoribonuclease 1 [Source:RefSeq peptide;Acc:NP_001018450]
Human Orthologue:
ERI1
Human Description:
exoribonuclease 1 [Source:HGNC Symbol;Acc:23994]
Mouse Orthologue:
Eri1
Mouse Description:
exoribonuclease 1 Gene [Source:MGI Symbol;Acc:MGI:1914526]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17426 Essential Splice Site Available for shipment Available now
sa1351 Nonsense Available for shipment Available now
sa23905 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065671 Essential Splice Site 154 337 3 7
Genomic Location:
Chromosome 21 (position 18741169)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCATTGAGTTCCCCATGGTGTTGATCGACACACACACNNTGGAGATTG[T/C]GAGTTGGTGAGGGAGCGGTCTGGCAACMTTGTGCRTGATTCTTGCCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065671 Nonsense 169 337 4 7
Genomic Location:
Chromosome 21 (position 18740956)
KASP Assay ID:
554-1265.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGCAGGTAGACTCGTTTCAGGAGTATGTGAAGCCAGTGCTGCACCCA[C/T]AGCTCTCTGAGTTTTGTGTAAAACTTACCGGAATAACGCAGGCAAGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065671 Nonsense 230 337 6 7
Genomic Location:
Chromosome 21 (position 18738926)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAGTCTTGTCTGTGCAGGTCTTGGGACATGGGGAAATTTCTTCATACA[C/T]AGTGCAAACTGAGTCGCATCAGATACCCACAGTTTGCCAGAAAATGGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u9klb53w