dusp4

Ensembl ID:
ENSDARG00000044688
ZFIN ID:
ZDB-GENE-040426-709
Description:
dual specificity phosphatase 4 [Source:RefSeq peptide;Acc:NP_957465]
Human Orthologue:
DUSP4
Human Description:
dual specificity phosphatase 4 [Source:HGNC Symbol;Acc:3070]
Mouse Orthologue:
Dusp4
Mouse Description:
dual specificity phosphatase 4 Gene [Source:MGI Symbol;Acc:MGI:2442191]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39326 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065664 Nonsense 59 367 1 4
Genomic Location (Zv9):
Chromosome 21 (position 18948072)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20083561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGCGGTGCCGTTAATATTCGCTGTAACACGATCGTTCGGAGGCGAGCG[A/T]AAGGCTCCGTGAGTTTGGACCAGATTTTGTCTGGGGACGATGAAGCGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link