A1A5I3_DANRE

Ensembl ID:
ENSDARG00000044670
Description:
LOC557935 protein [Source:UniProtKB/TrEMBL;Acc:A1A5I3]
Human Orthologue:
ITGAL
Human Description:
integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide
Mouse Orthologue:
Itgal
Mouse Description:
integrin alpha L Gene [Source:MGI Symbol;Acc:MGI:96606]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31248 Nonsense Mutation detected in F1 DNA During 2016
sa17997 Nonsense Available for shipment Available now
sa3361 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31248
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065640 Nonsense 126 1155 5 31
Genomic Location:
Chromosome 1 (position 60017796)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCCCTCATGATTGTGATGGAAACTCGTATCTGAACGGCATCTGCTAC[C/T]AGTTCAACAGCGGCTTACAGGCCGTCTCCAACTTCACTGCCGCTTACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065640 Nonsense 170 1155 6 31
Genomic Location:
Chromosome 1 (position 60017499)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGTTTGATGGATCCCGCAGTATGAARCCAGAAGAKTTTRATCTGAAT[A/T]AAGACTTCATTAMAGATATCATGAAGAAACTGTCRAACTCCTCYATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065640 Nonsense 900 1155 23 31
Genomic Location:
Chromosome 1 (position 60010827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCAACAATGGAAACACGAGCGCTGCGGCGGTSAGGAGGWGTGTACCGGTT[C/T]AGTTCGCTGTCGATGTGGCCATCAGTCTGTGAGCAGCACTTATTCACTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link