A1A5I3_DANRE

Ensembl ID:
ENSDARG00000044670
Description:
LOC557935 protein [Source:UniProtKB/TrEMBL;Acc:A1A5I3]
Human Orthologue:
ITGAL
Human Description:
integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide
Mouse Orthologue:
Itgal
Mouse Description:
integrin alpha L Gene [Source:MGI Symbol;Acc:MGI:96606]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17997 Nonsense Available for shipment Available now
sa3361 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065640 Nonsense 170 1155 6 31
Genomic Location:
Chromosome 1 (position 60017499)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGTTTGATGGATCCCGCAGTATGAARCCAGAAGAKTTTRATCTGAAT[A/T]AAGACTTCATTAMAGATATCATGAAGAAACTGTCRAACTCCTCYATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065640 Nonsense 900 1155 23 31
Genomic Location:
Chromosome 1 (position 60010827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCAACAATGGAAACACGAGCGCTGCGGCGGTSAGGAGGWGTGTACCGGTT[C/T]AGTTCGCTGTCGATGTGGCCATCAGTCTGTGAGCAGCACTTATTCACTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6yylp6jh