hp1bp3

Ensembl ID:
ENSDARG00000044669
ZFIN ID:
ZDB-GENE-060810-79
Human Orthologue:
HP1BP3
Human Description:
heterochromatin protein 1, binding protein 3 [Source:HGNC Symbol;Acc:24973]
Mouse Orthologue:
Hp1bp3
Mouse Description:
heterochromatin protein 1, binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:109369]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2596 Essential Splice Site F2 line generated During 2017
sa35145 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2596
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077496 Essential Splice Site 247 595 5 12
Genomic Location (Zv9):
Chromosome 11 (position 38782257)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37349276
KASP Assay ID:
554-2765.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTACAAGAGGTCTCTGAAGCGAATGGTTGAGAAGGGTGTTGYCAGACAG[G/A]TGATTTGCATTTTAACACATGAGTATTTTTAGTTTTACATATACAGYAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077496 Essential Splice Site 431 595 10 12
Genomic Location (Zv9):
Chromosome 11 (position 38788320)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37355339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCATGGACTGAGTGGGTCATACCAGCTTAGTTATCCATTTTACCCAAG[G/A]TAAGTTCAATTGTAAGTTCAATGTAAAGAAGAGACCGTTGTGTAATAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link