C7U131_DANRE

Ensembl ID:
ENSDARG00000044635
Description:
Protein-tyrosine phosphatase delta-a [Source:UniProtKB/TrEMBL;Acc:C7U131]
Human Orthologue:
PTPRD
Human Description:
protein tyrosine phosphatase, receptor type, D [Source:HGNC Symbol;Acc:9668]
Mouse Orthologue:
Ptprd
Mouse Description:
protein tyrosine phosphatase, receptor type, D Gene [Source:MGI Symbol;Acc:MGI:97812]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9956 Essential Splice Site Available for shipment Available now
sa5455 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9703 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065586 None 116 361 2 7
ENSDART00000128634 Essential Splice Site 29 141 3 7
Genomic Location:
Chromosome 7 (position 75006922)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACGAAAGCTCACACCTCGCGGKTCATCAGTGCCAATCTGCCCTGCAA[C/T]AAATTCAAGAACCGGCTGGTGAACAKCATGCCGTACGAGTCGACGCGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5455
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065586 Essential Splice Site 156 361 2 7
ENSDART00000128634 Essential Splice Site 68 141 3 7
Genomic Location:
Chromosome 7 (position 75007042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGTGGAGGGCTCSGACTACATCAAYGGCAGCTTCATCGACGGATAYAG[G/T]TAAGCNNNACGATAGCACAAGACAATCCAGAACTTTCTGATTTAGTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9703
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065586 Nonsense 204 361 4 7
ENSDART00000128634 Nonsense 116 141 5 7
Genomic Location:
Chromosome 7 (position 75008554)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCAWCTTTGTRTGTGTGTGTGTGTTTCCAGGAGAAGTGCCATCAGTA[C/A]TGGCCCGCGGAGCGATCGGCCAGATATCAGTACTTTGTGGTGGATCCAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y8grdym4