myo7ab

Ensembl ID:
ENSDARG00000044632
ZFIN ID:
ZDB-GENE-091110-4
Human Orthologue:
MYO7A
Human Description:
myosin VIIA [Source:HGNC Symbol;Acc:7606]
Mouse Orthologue:
Myo7a
Mouse Description:
myosin VIIA Gene [Source:MGI Symbol;Acc:MGI:104510]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11875 Nonsense Available for shipment Available now
sa23923 Nonsense Available for shipment Available now
sa23924 Nonsense Mutation detected in F1 DNA During 2014
sa3116 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa11875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003181 Nonsense 659 2178 16 47
ENSDART00000148019 Nonsense 651 2098 15 46
Genomic Location:
Chromosome 21 (position 21233715)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATTCTCTTCTCTGCAGATGTTTGATAGAGGWCTGYGTGTCAGGCAGT[T/A]GCGCTACTCTGGGATGATGGAGACGATCCGCATACGCAGAGCTGGATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23923
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003181 Nonsense 1018 2178 22 47
ENSDART00000148019 Nonsense 1013 2098 21 46
Genomic Location:
Chromosome 21 (position 21237195)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCAAAGTTTGCTGCAACCTACTTCCAGGGAAATGCAACACACATGTA[T/A]GTACGCCGGCCACTGAAACAGCCTCTTTTGTTTCATGAAGATGAAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003181 Nonsense 1600 2178 34 47
ENSDART00000148019 Nonsense 1594 2098 33 46
Genomic Location:
Chromosome 21 (position 21248603)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATGCTTCGTTCCTGAGATTCTCAAAGGGAGATCTGATCTTTCTGGAT[G/T]AGCACACTGGAGAACAGGTCCTGACTTCAGGCTGGGCTCATGGGGTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3116
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003181 Nonsense 1888 2178 40 47
ENSDART00000148019 Nonsense 1882 2098 39 46
Genomic Location:
Chromosome 21 (position 21255530)
KASP Assay ID:
554-2750.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTCCTTTTTTRTTTGCAGGCTTTTGAGGTTGAATCCAGTACAAAAGCC[A/T]AAGATTTCTGCCGAAACATCGCCGGCAGGATGATGCTTCATTCCTCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/74gojtg2