alg8

Ensembl ID:
ENSDARG00000044627
ZFIN ID:
ZDB-GENE-030131-5812
Description:
probable dolichyl pyrophosphate Glc1Man9GlcNAc2 alpha-1,3-glucosyltransferase [Source:RefSeq peptid
Human Orthologue:
ALG8
Human Description:
asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae) [Source:HGN
Mouse Orthologue:
Alg8
Mouse Description:
asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase) Gene [Source:MGI Sy

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13303 Splice Site, Nonsense Available for shipment Available now
sa15959 Nonsense Available for shipment Available now
sa14637 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065565 Splice Site, Nonsense 30 524 2 13
Genomic Location:
Chromosome 21 (position 22008162)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AANNNNNTTTTGTATAAAATTGTCATTTTTAAAACTTTTTTGTATTTCAG[T/G]CACTCTACGGATTTTGAAGTGCATAGGAACTGGCKCGCCCTGACTCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15959
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065565 Nonsense 73 524 3 13
Genomic Location:
Chromosome 21 (position 22009190)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTACATCTGAGTGGACGKTGGATTATCCTCCTCTGTTTGCYTGGTTT[G/T]AATATGGACTTTCTCATATTGCCCGATTTTTTGATAAGGAGATGCTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065565 Nonsense 460 524 13 13
Genomic Location:
Chromosome 21 (position 22015987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATAATTCAGGAAAGGCGGTAGTTTGTTGAATCCACTGGAGTCAATKTA[T/A]CTCTTGGGCCTGATTCCTCTTGAGCTTGTCTGTGAGTTTATTTACCCGCY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7dyl7hdg