ccdc90b

Ensembl ID:
ENSDARG00000044626
ZFIN ID:
ZDB-GENE-040724-162
Description:
coiled-coil domain containing 90B [Source:RefSeq peptide;Acc:NP_001159730]
Human Orthologue:
CCDC90B
Human Description:
coiled-coil domain containing 90B [Source:HGNC Symbol;Acc:28108]
Mouse Orthologue:
Ccdc90b
Mouse Description:
coiled-coil domain containing 90B Gene [Source:MGI Symbol;Acc:MGI:1913615]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18296 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18296
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065563 Essential Splice Site 197 253 7 9
Genomic Location:
Chromosome 21 (position 22004623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAACAAGAGAAGAAACTGATGGATGTTAGAATGGAGTTTCAAAAAATG[G/T]TAAGACAAAAGCAATCGTTTGATTACTTTAAATTGGTATGGAAACATAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4wz06qsz