pcf11

Ensembl ID:
ENSDARG00000044625
ZFIN ID:
ZDB-GENE-041114-175
Description:
cleavage and polyadenylation factor subunit, homolog [Source:RefSeq peptide;Acc:NP_001007308]
Human Orthologue:
PCF11
Human Description:
PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Pcf11
Mouse Description:
cleavage and polyadenylation factor subunit homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23932 Essential Splice Site Available for shipment Available now
sa37303 Nonsense Mutation detected in F1 DNA During 2017
sa23933 Nonsense Available for shipment Available now
sa43640 Nonsense Mutation detected in F1 DNA During 2017
sa43641 Nonsense Mutation detected in F1 DNA During 2017
sa43642 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065562 Essential Splice Site 544 1457 5 16
Genomic Location (Zv9):
Chromosome 21 (position 21997956)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22846369
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTAAAAGATGGCAAGAGGTGGAGGAGTGGATGGGAAGAAAACAAACA[G/A]TATGTCATTTCAATTACTTGCACCTTTTGTCTTAATTATATTCAATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065562 Nonsense 556 1457 6 16
Genomic Location (Zv9):
Chromosome 21 (position 21998072)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22846485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAACTTTGTTTTAGTCCTAAACACTCAGATACAGATCTGTCACATGGG[C/T]GAATGGGGATCCAGAAACACAAAACTTGGAACACTAATCAAAGACCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23933
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065562 Nonsense 704 1457 8 16
Genomic Location (Zv9):
Chromosome 21 (position 21998789)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22847202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTTTGCATGAAATGTATCACTATCCGCCTCATCATGAAGTATCTGAA[C/T]AATATAGTGAAAGCTTGGATGTGCATAAAATGTCAGGTGATCCCATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065562 Nonsense 998 1457 8 16
Genomic Location (Zv9):
Chromosome 21 (position 21999671)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22848084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGATATGAGGAACCACATTTTCCAGCTAGGATAATTAATTATGATGAA[C/T]AGCAGGGTCCAGTTAGATTTGATAACCCAACATGTGGGATTCGTTTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065562 Nonsense 1022 1457 8 16
Genomic Location (Zv9):
Chromosome 21 (position 21999744)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22848157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACCCAACATGTGGGATTCGTTTTGAGAACCCTGTGCAGCCTGAACCCT[T/G]AAGGTTCGATGCACCACCTGTCATGCCAAGATATGACCCACAGGGCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065562 Nonsense 1091 1457 8 16
Genomic Location (Zv9):
Chromosome 21 (position 21999950)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22848363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCAATTTCAACATGCCACCCATAAACTCATTTGGTGGTCCAGCCCAG[C/T]AGTTTTCCATGCAGCAAAATGTCTCGCAAACCTCCAACTTCAGTGTGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link