POLQ

Ensembl ID:
ENSDARG00000044622
Description:
polymerase (DNA directed), theta [Source:HGNC Symbol;Acc:9186]
Human Orthologue:
POLQ
Human Description:
polymerase (DNA directed), theta [Source:HGNC Symbol;Acc:9186]
Mouse Orthologue:
Polq
Mouse Description:
polymerase (DNA directed), theta Gene [Source:MGI Symbol;Acc:MGI:2155399]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13096 Nonsense Available for shipment Available now
sa15872 Nonsense Available for shipment Available now
sa13310 Nonsense Available for shipment Available now
sa37302 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065556 Nonsense 345 2576 5 32
Genomic Location (Zv9):
Chromosome 21 (position 21981922)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22830335
KASP Assay ID:
2261-5601.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACATTGGTTTCTGAGTTGCTGAWCTTGAAGAGAGTGCTGGAAACAAGA[C/T]AGAAAGCCATGTTCATTCTTCCGTTCGTGTCTGTGGCGAGAGAGAAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065556 Nonsense 445 2576 7 32
Genomic Location (Zv9):
Chromosome 21 (position 21981395)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22829808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGGGACTCTGGTCGTGGAKATCTGTTAGAGCTTTTGCTTACTAAAATA[C/T]GATACATTGCCCAAAAAACTGCAACASGGTATGTTAWAAYGGAATTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065556 Nonsense 859 2576 15 32
Genomic Location (Zv9):
Chromosome 21 (position 21977489)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22825902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATGGGTTTTTAACAGTCATGTCACWTATTTAAGATAACCCCTGTGTA[T/A]GTGGACTGGACRACAATAGACTGGTATCAGTTTTTCTGTCTTTGGGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065556 Nonsense 1079 2576 18 32
Genomic Location (Zv9):
Chromosome 21 (position 21975473)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22823886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATCTGGGTCAGTGGGAAAAAGGCATTGACTGAAAGAGAAGCTGCCCAG[C/T]AGATCGTGGCTGAAGCCCAGCTGCTCCTCCAGAAAGATCTGGCTCTTCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aging (facial): A genome-wide association study in Caucasian women points out a putative role of the STXBP5L gene in facial photoaging. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link