NP_998007.1

Ensembl ID:
ENSDARG00000044615
Description:
protein kinase Npk [Source:RefSeq peptide;Acc:NP_998007]
Human Orthologue:
AC013461.1
Human Description:
Mitogen-activated protein kinase kinase kinase MLT [Source:UniProtKB/Swiss-Prot;Acc:Q9NYL2]
Mouse Orthologue:
B230120H23Rik
Mouse Description:
RIKEN cDNA B230120H23 gene Gene [Source:MGI Symbol;Acc:MGI:2443258]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20621 Nonsense Available for shipment Available now
sa9459 Essential Splice Site Available for shipment Available now
sa8824 Essential Splice Site Available for shipment Available now
sa20622 Nonsense Available for shipment Available now
sa33801 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065551 Nonsense 41 371 2 11
Genomic Location (Zv9):
Chromosome 6 (position 6848315)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6774331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGCGTGAATGTCAGTATGAGATGTCGTCCCTCAGCGCCAGTTTCGTT[C/T]AGATCCCTTTCGATGACATTCGCTTTTATGAGAACTGCGGCGGCGGGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065551 Essential Splice Site 84 371 2 11
ENSDART00000065551 Essential Splice Site 84 371 2 11
Genomic Location (Zv9):
Chromosome 6 (position 6848448)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6774464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGATAAAGAAGTGGCTGTCAAAAAACTGCTGAAGATTGATGCCGAGG[T/G]TTGTACAGACTCAGTTTGTTTGGTGATGGAWGTATTATTGTCAGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8824
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065551 Essential Splice Site 84 371 2 11
ENSDART00000065551 Essential Splice Site 84 371 2 11
Genomic Location (Zv9):
Chromosome 6 (position 6848448)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6774464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGATAAAGAAGTGGCTGTCAAAAAACTGCTGAAGATTGATGCCGAGG[T/G]TTGTACAGACTCAGTTTGTTTGGTGATGGAWGTATTATTGTCAGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065551 Nonsense 163 371 5 11
Genomic Location (Zv9):
Chromosome 6 (position 6859633)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6785649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTAGGAATGCATTATTTACATGCCGAGGCTCCTCTGAAAGTCATTCAT[A/T]GAGACCTGAAGTCGAGAAATGGTGAGATTTTAGTTGTTCTGTGAGCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065551 Nonsense 274 371 9 11
Genomic Location (Zv9):
Chromosome 6 (position 6872267)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6798283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCCCAGCAGCTGCCCCGCCAGCTTTGCAGACCTGATGAGACGCTGCTG[G/A]AATGCTGAACCCAAGGTACTTGAATGGGACAGGGCCGAAAAATCAGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link