LOC100005187

Ensembl ID:
ENSDARG00000044591

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23973 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11686 Essential Splice Site Available for shipment Available now
sa23974 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041939 Essential Splice Site 151 602 4 22
ENSDART00000065497 Essential Splice Site 151 298 4 10
Genomic Location:
Chromosome 21 (position 29314082)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGTCCTACAGACTCGTCGCAGCTGATTTCACCAAGATGAAGAGAGGG[T/C]GAGACGTGTGCTCTGGTGAAATGTCCCATAATCAAGTGGCCACATTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041939 Essential Splice Site 220 602 6 22
ENSDART00000065497 Essential Splice Site 220 298 6 10
Genomic Location:
Chromosome 21 (position 29316977)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGATCCGCATCTTTGCTGCTTACAATGAGGGAGTCATTAATCTGCTAGG[T/G]AAARYTTMAAAAGTTCAAAGTGCAAAAATAAAACACAGAAAATCAAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041939 Nonsense 383 602 13 22
ENSDART00000065497 None None 298 None 10
Genomic Location:
Chromosome 21 (position 29330535)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATGAAAAGTACAGTTTGAGCAGTGTAGCCTGAATACAGTCTGATTCA[C/T]AAATGAATGACTCTTATGAACTAATTCTCACCGGCTGGGTAAGTTGGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g2vamuoq