chst8

Ensembl ID:
ENSDARG00000044577
ZFIN ID:
ZDB-GENE-090410-1
Human Orthologue:
CHST8
Human Description:
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 [Source:HGNC Symbol;Acc:15993]
Mouse Orthologue:
Chst8
Mouse Description:
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 Gene [Source:MGI Symbol;Acc:MGI:1916197]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1883 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065481 Nonsense 86 343 1 1
Genomic Location:
Chromosome 18 (position 1497678)
KASP Assay ID:
554-1873.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAGACGTTCAGGAGGCCCGCAAACGCATCGTACGTGAAGTCTGCGGG[A/T]AATACCGCAGTAATATTTCCCGAACGATAACGCCACATCATGTATCGCGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
  • Weight: Genome-wide association yields new sequence variants at seven loci that associate with measures of obesity. (View Study)
  • Working memory: Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xa4ggxq4