rbms3

Ensembl ID:
ENSDARG00000044574
ZFIN ID:
ZDB-GENE-060929-244
Description:
RNA-binding motif, single-stranded-interacting protein 3 [Source:RefSeq peptide;Acc:NP_001070184]
Human Orthologue:
RBMS3
Human Description:
RNA binding motif, single stranded interacting protein 3 [Source:HGNC Symbol;Acc:13427]
Mouse Orthologue:
Rbms3
Mouse Description:
RNA binding motif, single stranded interacting protein Gene [Source:MGI Symbol;Acc:MGI:2444477]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8820 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091277 Nonsense 230 381 9 14
ENSDART00000125804 Nonsense 264 415 9 14
ENSDART00000136719 Nonsense 264 415 9 13
ENSDART00000136766   None 144 None 5
ENSDART00000137079   None 194 None 7
ENSDART00000138388 Nonsense 258 409 9 14

The following transcripts of ENSDARG00000044574 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 42342882)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 39726332
KASP Assay ID:
2261-0140.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTRCTAATAKTGTATTGCGTTTCTTCCAGGTTCTACTCCTCACCCTA[C/A]AGCATCTCCACAAACCGCATGATCGCTCAAACGTCAATCACTCCATTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link