cdc42

Ensembl ID:
ENSDARG00000044573
ZFIN IDs:
ZDB-GENE-030131-8783, ZDB-GENE-030131-8783
Description:
cell division cycle 42 isoform 2 [Source:RefSeq peptide;Acc:NP_001018130]
Human Orthologue:
CDC42
Human Description:
cell division cycle 42 (GTP binding protein, 25kDa) [Source:HGNC Symbol;Acc:1736]
Mouse Orthologue:
Cdc42
Mouse Description:
cell division cycle 42 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:106211]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4434 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4434
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053432 None None 191 None 5
ENSDART00000130384 Essential Splice Site None 190 2 6
Genomic Location:
Chromosome 11 (position 40368693)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATGAASGAGTAATGTTTCTCCTGTGTGAACGCTCTTGWTTTTCTTTGC[A/T]GATCTTGAATGAGAGCAGTGGATTTATAAAAGCACAGCTATGCAGACGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/udy3uvg1