fabp6

Ensembl ID:
ENSDARG00000044566
ZFIN ID:
ZDB-GENE-040625-49
Description:
gastrotropin [Source:RefSeq peptide;Acc:NP_001002076]
Human Orthologue:
FABP6
Human Description:
fatty acid binding protein 6, ileal [Source:HGNC Symbol;Acc:3561]
Mouse Orthologue:
Fabp6
Mouse Description:
fatty acid binding protein 6, ileal (gastrotropin) Gene [Source:MGI Symbol;Acc:MGI:96565]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4953 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065448 Essential Splice Site 111 131 3 4
Genomic Location:
Chromosome 21 (position 28790957)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCAAATATCAACAAACAACTGAGATCAGCGGTGGAAAGYTGGTGGAGG[T/C]GAGATAAATCAVATATTTTACTAYATTGAGGATTMTTATAATTCTAGGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kly94j7x