ola1

Ensembl ID:
ENSDARG00000044565
ZFIN ID:
ZDB-GENE-030131-5063
Description:
Obg-like ATPase 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZU42]
Human Orthologue:
OLA1
Human Description:
Obg-like ATPase 1 [Source:HGNC Symbol;Acc:28833]
Mouse Orthologue:
Ola1
Mouse Description:
Obg-like ATPase 1 Gene [Source:MGI Symbol;Acc:MGI:1914309]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14733 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045299 Essential Splice Site 124 396 4 11
ENSDART00000135093 Essential Splice Site 129 252 4 8
Genomic Location:
Chromosome 6 (position 10661821)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCCTTCCTCTCCAAYATCTTTGCCTGTGATGCCATCTTTCACATGACCC[G/A]TGAGTACATTATSAKATTWAGATTTGAGTTTAGCTCTAACTGGGGTTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/09iyp3ic