hif1al2

Ensembl ID:
ENSDARG00000044550
ZFIN ID:
ZDB-GENE-050211-2
Description:
hypoxia-inducible factor 1, alpha subunit, like 2 [Source:RefSeq peptide;Acc:NP_001012371]
Human Orthologues:
EPAS1, HIF1A, HIF3A
Human Descriptions:
endothelial PAS domain protein 1 [Source:HGNC Symbol;Acc:3374]
hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) [Source:HGNC
hypoxia inducible factor 3, alpha subunit [Source:HGNC Symbol;Acc:15825]
Mouse Orthologues:
Epas1, Hif1a, Hif3a
Mouse Descriptions:
endothelial PAS domain protein 1 Gene [Source:MGI Symbol;Acc:MGI:109169]
hypoxia inducible factor 1, alpha subunit Gene [Source:MGI Symbol;Acc:MGI:106918]
hypoxia inducible factor 3, alpha subunit Gene [Source:MGI Symbol;Acc:MGI:1859778]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23956 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065407 Nonsense 578 660 14 14
ENSDART00000130632 Nonsense 581 663 14 14
Genomic Location (Zv9):
Chromosome 21 (position 26722524)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27291435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTATATACGTGTGTGCTGCATTTCCACTAGATGGATCAACACCACCAT[G/A]GATATGTGACGGACACTTGAATCATCTTGAACCGAAGTTCAGATCACTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link