nr4a2b

Ensembl ID:
ENSDARG00000044532
ZFIN IDs:
ZDB-GENE-040718-103, ZDB-GENE-990415-184
Description:
nuclear receptor subfamily 4, group A, member 2b [Source:RefSeq peptide;Acc:NP_001002406]
Human Orthologue:
NR4A2
Human Description:
nuclear receptor subfamily 4, group A, member 2 [Source:HGNC Symbol;Acc:7981]
Mouse Orthologue:
Nr4a2
Mouse Description:
nuclear receptor subfamily 4, group A, member 2 Gene [Source:MGI Symbol;Acc:MGI:1352456]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40651 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065385 Essential Splice Site 449 586 7 8
Genomic Location (Zv9):
Chromosome 6 (position 12377100)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12230322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTACATTTTTAAAAGACATAATATAATAACTTTTCAATTTTCTCACC[A/T]GATCTAACCTGCCAGAGGACAAACTCATCTTTTGCAACGGAATGGTTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link