camk1g

Ensembl ID:
ENSDARG00000044526
ZFIN ID:
ZDB-GENE-030131-7594
Description:
calcium/calmodulin-dependent protein kinase IG [Source:RefSeq peptide;Acc:NP_956260]
Human Orthologue:
CAMK1G
Human Description:
calcium/calmodulin-dependent protein kinase IG [Source:HGNC Symbol;Acc:14585]
Mouse Orthologue:
Camk1g
Mouse Description:
calcium/calmodulin-dependent protein kinase I gamma Gene [Source:MGI Symbol;Acc:MGI:2388073]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43741 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065380 Essential Splice Site 71 426 None 12

The following transcripts of ENSDARG00000044526 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 1037378)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1040290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAACTCCCGCACAACACATCTATAACTCCTATAATCGGTGTCTGTTTC[A/G]GGATAAAGCACAGTAATGTCGTGGGTCTGGAGGATTTCTATGAAAGCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link