pparda

Ensembl ID:
ENSDARG00000044525
ZFIN ID:
ZDB-GENE-990415-212
Description:
Peroxisome proliferator-activated receptor beta 1 [Source:UniProtKB/TrEMBL;Acc:Q90Z67]
Human Orthologue:
PPARD
Human Description:
peroxisome proliferator-activated receptor delta [Source:HGNC Symbol;Acc:9235]
Mouse Orthologue:
Ppard
Mouse Description:
peroxisome proliferator activator receptor delta Gene [Source:MGI Symbol;Acc:MGI:101884]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13252 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13252
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123458 Essential Splice Site 197 496 3 7
Genomic Location (Zv9):
Chromosome 22 (position 991985)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 994897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTCTGCCGCTTTCAGAAGTGCCTGATGCTCGGGATGTCTCACGACGG[T/G]GAGCGATGACWCTAACACACACGGTTATTWCACTAAAYTRAAACCAGCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link