DEF6 (2 of 2)

Ensembl ID:
ENSDARG00000044524
Description:
differentially expressed in FDCP 6 homolog (mouse) [Source:HGNC Symbol;Acc:2760]
Human Orthologue:
DEF6
Human Description:
differentially expressed in FDCP 6 homolog (mouse) [Source:HGNC Symbol;Acc:2760]
Mouse Orthologue:
Def6
Mouse Description:
differentially expressed in FDCP 6 Gene [Source:MGI Symbol;Acc:MGI:1346328]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39353 Essential Splice Site Mutation detected in F1 DNA During 2017
sa29683 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065377 Essential Splice Site 79 615 2 11
Genomic Location (Zv9):
Chromosome 22 (position 960621)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 963533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCAGCCAGGGGTACATGCCCTACCTGAACCAGTTCATTCTGGACAAG[G/A]TGCAAAACAACACACACAAATACACACACACAAACACACACACTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065377 Nonsense 529 615 10 11
Genomic Location (Zv9):
Chromosome 22 (position 972634)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 975546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTTAGCAGCATATTCATGAGTTTATCCATCCGCAGGCTGCTCAGCGT[A/T]AACTCCGGCAGGCCAGTACGAGTGTTAAACACTGGAACGTCCAGATGAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link