eef1b2

Ensembl ID:
ENSDARG00000044521
ZFIN ID:
ZDB-GENE-030131-7310
Description:
elongation factor 1-beta [Source:RefSeq peptide;Acc:NP_956243]
Human Orthologue:
EEF1B2
Human Description:
eukaryotic translation elongation factor 1 beta 2 [Source:HGNC Symbol;Acc:3208]
Mouse Orthologue:
Eef1b2
Mouse Description:
eukaryotic translation elongation factor 1 beta 2 Gene [Source:MGI Symbol;Acc:MGI:1929520]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40653 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065373 Nonsense 215 225 6 6

The following transcripts of ENSDARG00000044521 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 13111069)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12967559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGAACAGACCAGCTAGAGGAACTGATCACAGCCTTTGAGGACTATGTA[C/T]AGTCCATGGATGTGGCAGCCTTCAACAAGATCTAAAACCCCACAGCACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link