etv5b

Ensembl ID:
ENSDARG00000044511
ZFIN ID:
ZDB-GENE-991228-4
Description:
ets variant 5b [Source:RefSeq peptide;Acc:NP_571280]
Human Orthologues:
ETV1, ETV4
Human Descriptions:
ets variant 1 [Source:HGNC Symbol;Acc:3490]
ets variant 4 [Source:HGNC Symbol;Acc:3493]
Mouse Orthologues:
Etv1, Etv4, Gm5454
Mouse Descriptions:
ets variant gene 1 Gene [Source:MGI Symbol;Acc:MGI:99254]
ets variant gene 4 (E1A enhancer binding protein, E1AF) Gene [Source:MGI Symbol;Acc:MGI:99423]
predicted gene 5454 Gene [Source:MGI Symbol;Acc:MGI:3648286]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40656 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30870 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065361 Essential Splice Site 46 524 3 12
ENSDART00000127548 Essential Splice Site 46 526 3 12
ENSDART00000065361 Essential Splice Site 46 524 3 12
ENSDART00000127548 Essential Splice Site 46 526 3 12
Genomic Location (Zv9):
Chromosome 6 (position 13949048)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 13909010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCGAAAAAGGAAGTTTGTTGACACCGAGCTGGCACAGGATACAGAGGG[T/C]AAACAAATGAACATGCAATCAATCCATCCAGATCTCTTTAAACCACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065361 Essential Splice Site 46 524 3 12
ENSDART00000127548 Essential Splice Site 46 526 3 12
ENSDART00000065361 Essential Splice Site 46 524 3 12
ENSDART00000127548 Essential Splice Site 46 526 3 12
Genomic Location (Zv9):
Chromosome 6 (position 13949048)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 13909010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCGAAAAAGGAAGTTTGTTGACACCGAGCTGGCACAGGATACAGAGGG[T/C]AAACAAATGAACATGCAATCAATCCATCCAGATCTCTTTAAACCACATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link