tlr9

Ensembl ID:
ENSDARG00000044490
ZFIN ID:
ZDB-GENE-040219-10
Description:
toll-like receptor 9 [Source:RefSeq peptide;Acc:NP_001124066]
Human Orthologues:
RP11-330H6.5, TLR9
Human Descriptions:
TLR9 [Source:UniProtKB/TrEMBL;Acc:C3W5P5]
toll-like receptor 9 [Source:HGNC Symbol;Acc:15633]
Mouse Orthologue:
Tlr9
Mouse Description:
toll-like receptor 9 Gene [Source:MGI Symbol;Acc:MGI:1932389]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1171 Nonsense Confirmed mutation in F2 line During 2014
sa10328 Nonsense Available for shipment Available now
sa12600 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1171
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124218 Nonsense 642 1069 2 2
Genomic Location:
Chromosome 8 (position 55865749)
KASP Assay ID:
554-1081.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGTATCTCATTTTCTCTGGGAATCGTTTGGACATATTGTGGGACTCTT[G/A]GCGTAATCAATACATAAACCTCTTTCAGGGACTCACCAACCTTACGCACT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124218 Nonsense 732 1069 2 2
Genomic Location:
Chromosome 8 (position 55866019)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCRTACTTRCCYAATATTAACWTTGAGCTCCRKCTCACAGGACTGGATT[T/G]AAGTCACAACCGACTGGTTGCAATTCCAAAGGTATTCCTTAGTCAGKCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124218 Nonsense 1045 1069 2 2
Genomic Location:
Chromosome 8 (position 55866959)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTCAGTTCTGTCCTGGCCCAGAAAYCCMYGAGTGCAGCCGCTCTTCTG[G/A]AATGACCTGCGCGTCGCTCTCGTTTCTGACAATRTTAGAGCCTACAACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h4qlfyxk