sall4

Ensembl ID:
ENSDARG00000044485
ZFIN ID:
ZDB-GENE-060328-2
Description:
sal-like protein 4 [Source:RefSeq peptide;Acc:NP_001074078]
Human Orthologue:
SALL4
Human Description:
sal-like 4 (Drosophila) [Source:HGNC Symbol;Acc:15924]
Mouse Orthologue:
Sall4
Mouse Description:
sal-like 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2139360]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14110 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14110
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065331 Nonsense 695 1091 2 4
Genomic Location (Zv9):
Chromosome 23 (position 39051198)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39233082
KASP Assay ID:
2261-8150.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATGGGCATGAGGAGAGTATGGAGGAACAAGACTTTGAMTTGGACAAT[C/T]AGGAGAAGCTGAACTATTCTACAGAGCCCCAGCCTGTCACTAAAGACGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Male infertility: Genome-wide study of single-nucleotide polymorphisms associated with azoospermia and severe oligozoospermia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link