cdc23

Ensembl ID:
ENSDARG00000044484
ZFIN ID:
ZDB-GENE-040426-866
Description:
cell division cycle protein 23 homolog [Source:RefSeq peptide;Acc:NP_957227]
Human Orthologue:
CDC23
Human Description:
cell division cycle 23 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:1724]
Mouse Orthologue:
Cdc23
Mouse Description:
CDC23 (cell division cycle 23, yeast, homolog) Gene [Source:MGI Symbol;Acc:MGI:1098815]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3125 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa3125
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065325 Essential Splice Site 201 579 6 16

The following transcripts of ENSDARG00000044484 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 33822378)
KASP Assay ID:
554-3075.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGGGATCATGGCTGGAGCTGTGCAATCTCATCACCAACATTGAAATG[G/A]TACATCTTTTCWTAACCAACCTTGCCAATCACATTGAAAGTATGCTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/98vset9h