gfi1.2

Ensembl ID:
ENSDARG00000044457
ZFIN ID:
ZDB-GENE-040116-8
Description:
zinc finger protein Gfi-1 [Source:RefSeq peptide;Acc:NP_958495]
Human Orthologue:
GFI1
Human Description:
growth factor independent 1 transcription repressor [Source:HGNC Symbol;Acc:4237]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38552 Nonsense Mutation detected in F1 DNA During 2017
sa40706 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38552
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065139 Nonsense 387 396 6 6
Genomic Location (Zv9):
Chromosome 6 (position 28717890)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29013533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGATGTGACCTTTGTGGAAAAGGATTCCAGCGCAAGGTTGATTTAAGA[A/T]GACATAAGGAAACACAGCACGGACTGAAGTGAGGAAACATGCGTCCACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065139 Nonsense 392 396 6 6
Genomic Location (Zv9):
Chromosome 6 (position 28717875)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29013518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAAAAGGATTCCAGCGCAAGGTTGATTTAAGAAGACATAAGGAAACA[C/T]AGCACGGACTGAAGTGAGGAAACATGCGTCCACGAGATTCAGACTTTACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link