pcyt1bb

Ensembl ID:
ENSDARG00000044456
ZFIN ID:
ZDB-GENE-051120-48
Description:
phosphate cytidylyltransferase 1, choline, beta b [Source:RefSeq peptide;Acc:NP_001032451]
Human Orthologue:
PCYT1B
Human Description:
phosphate cytidylyltransferase 1, choline, beta [Source:HGNC Symbol;Acc:8755]
Mouse Orthologue:
Pcyt1b
Mouse Description:
phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI Symbol;Acc:MGI:2147987]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38151 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39499 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081198 Essential Splice Site 68 359 3 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3460 (position 54877)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40601929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAAAATGCTGAATCAAAATTGAAAGTACATGTCGTTTGTTTTTGTGC[A/T]GCTCAACGGCCAGTCCGAGTGTACGCCGATGGAATATTTGACCTCTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081198 Essential Splice Site 158 359 5 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3460 (position 58437)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40598369
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCATAGTGTCATACTGTACCTAATGTCTTTATTTTCCCATCGTCCTC[A/T]GATTGACTTTGTGGCGCATGATGATATCCCATACACCTCTGCGGGATCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link