CDHR1 (2 of 2)

Ensembl ID:
ENSDARG00000044447
Description:
cadherin-related family member 1 [Source:HGNC Symbol;Acc:14550]
Human Orthologues:
CDH23, CDHR1
Human Descriptions:
cadherin-related 23 [Source:HGNC Symbol;Acc:13733]
cadherin-related family member 1 [Source:HGNC Symbol;Acc:14550]
Mouse Orthologue:
Cdhr1
Mouse Description:
cadherin-related family member 1 Gene [Source:MGI Symbol;Acc:MGI:2157782]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35383 Nonsense Available for shipment Available now
sa22186 Essential Splice Site Available for shipment Available now
sa18079 Nonsense Available for shipment Available now
sa22185 Essential Splice Site Available for shipment Available now
sa35382 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22184 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065278 Nonsense 39 755 1 15
Genomic Location (Zv9):
Chromosome 12 (position 50606370)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48973214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTGATAAGGGCTCTAAACAGTTCTTCAGTGTGGAGCCCAAATCTGGC[A/T]GAGTGACCCTGGTGGAGCATCTGGACAGAGAGGTCAGAGGTCATGCGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065278 Essential Splice Site 156 755 5 15
Genomic Location (Zv9):
Chromosome 12 (position 50600187)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48967031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGGACTTTGAGACGTCACGGACACATTTCATCACTGTGGTGGCAAAG[G/A]TGAAGCCCTGAGCATCCAGCGCTCATGTGGATCTTCAACAAAAGTGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065278 Nonsense 203 755 7 15
Genomic Location (Zv9):
Chromosome 12 (position 50599406)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48966250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAYGAGGTGCAGAAACTGAGCTCTSCTSATGGTTTTGTGTCCAGGGTT[C/A]AGAGATTTTTACTGTTTTTGCGAAGGATGGAGMCCAGAGCAGCCCCAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065278 Essential Splice Site 330 755 9 15
Genomic Location (Zv9):
Chromosome 12 (position 50597134)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48963978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAGAAATCCTGCGCGGACTAAAGATCACTGTCAACGACTCCGACCAG[G/A]TGAAGGGCACTGAACACTAAACAGTGGACACTAGACAGTGAACACTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065278 Essential Splice Site 536 755 14 15
Genomic Location (Zv9):
Chromosome 12 (position 50593999)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48960843
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTAGAGCGATGATACATCTGTGGTTATGTGAATACCCGACTGTGTTCA[G/A]GCGGTGGACGAGGACGCAGAGGAGCCCAATAACCTGATCGAGTACTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22184
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065278 Nonsense 583 755 14 15
Genomic Location (Zv9):
Chromosome 12 (position 50593857)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48960701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGGGCGAGATCAAGCTCAAACCCTACATCAAGAGTCTGGAGATCGTG[C/T]AGAACATCAGTAGGCAGAGGGAGTGCCGCTGGTCCGTGGTGGTGCAGGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Vitiligo: Association analyses identify three susceptibility Loci for vitiligo in the Chinese Han population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link