si:ch73-194h10.2

Ensembl ID:
ENSDARG00000044441
ZFIN ID:
ZDB-GENE-100921-21
Human Orthologue:
MYO7B
Human Description:
myosin VIIB [Source:HGNC Symbol;Acc:7607]
Mouse Orthologue:
Myo7b
Mouse Description:
myosin VIIB Gene [Source:MGI Symbol;Acc:MGI:107709]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40701 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40702 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40703 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa15693 Splice Site, Nonsense Available for shipment Available now
sa10082 Essential Splice Site Available for shipment Available now
sa20714 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Essential Splice Site 192 2179 5 49
ENSDART00000143218   None 1419 None 30
Genomic Location (Zv9):
Chromosome 6 (position 27771339)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28072550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTCCTGGATTGAGCAGCAAGTTCTAGAGGCCAACCCTATCTTAGAAGG[T/C]ACAGTTACATACACTTACATCTTCCTTATATTTCCTCCAGTAAACATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Essential Splice Site 596 2179 15 49
ENSDART00000143218   None 1419 None 30
Genomic Location (Zv9):
Chromosome 6 (position 27778813)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28080024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGATTTAAATTACTTTGATTTGCATTCCCTTTTGTTTCTCACCCCATC[A/T]GCAAACAGCAGACACAAAGAAGCAAGTTCCAACATTAACTGGTCAGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Nonsense 1754 2179 39 49
ENSDART00000143218 Splice Site None 1419 None 30
Genomic Location (Zv9):
Chromosome 6 (position 27804614)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28105825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGTTGGCGTGCACCTATTTTGAAGTATATGGGTGATTATCCCACCAGA[C/T]AGGTTCAGAGCCCTCTGGAGCTCACAGATCAGATCTTTGGCCCACCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Splice Site, Nonsense 1918 2179 42 49
ENSDART00000143218 Splice Site, Nonsense 1155 1419 22 30
Genomic Location (Zv9):
Chromosome 6 (position 27814656)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28115867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGYTGTCCACAGCTGAAGGTTTCAGCCTCTTCAWGAAAACTCCTGAY[A/T]AGGTTTGTTCCTARTSTACCATGATTTATATTTAACAGCCAGGACTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10082
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Essential Splice Site 1984 2179 44 49
ENSDART00000143218 Essential Splice Site 1221 1419 24 30
Genomic Location (Zv9):
Chromosome 6 (position 27815621)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28116832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCCCTGGGAGAGATGTGGAGGCAGATCTCATCTTCCATTACCCACAGG[T/A]ACTGAAATGTATGGTAAAATTCCCATGTAAGCTTTCYAAAAATATCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065268 Nonsense 2068 2179 46 49
ENSDART00000143218 Nonsense 1305 1419 26 30
Genomic Location (Zv9):
Chromosome 6 (position 27817484)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28118695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACAACAAGCAAACGGGCATGACTGTGGAAGAGGCAATGATCGGCTTTT[T/A]GAAGATTGTCTATAAATGGCCCACATTTGGATGTGCCTTTTTTGATGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link