ppig

Ensembl ID:
ENSDARG00000044431
ZFIN ID:
ZDB-GENE-040426-2822
Description:
peptidyl-prolyl cis-trans isomerase G [Source:RefSeq peptide;Acc:NP_998629]
Human Orthologue:
PPIG
Human Description:
peptidylprolyl isomerase G (cyclophilin G) [Source:HGNC Symbol;Acc:14650]
Mouse Orthologue:
Ppig
Mouse Description:
peptidyl-prolyl isomerase G (cyclophilin G) Gene [Source:MGI Symbol;Acc:MGI:2445173]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33793 Nonsense Mutation detected in F1 DNA During 2017
sa33794 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065256 Nonsense 62 687 4 13
Genomic Location (Zv9):
Chromosome 6 (position 3508573)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3535826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTGAAAAAGGAGTTGGCAAGACTACTCAGAAACCATTGCATTACAAA[G/T]GAACTCCTTTCCACAGGATAGTGAAGGATTTCATGATACAAGGAGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065256 Nonsense 610 687 13 13
Genomic Location (Zv9):
Chromosome 6 (position 3519656)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3546909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGACCGGAGGAAGAGTGCAGACAATAAAAGCAGAGAAACACGAGGA[C/T]GAGACCGCAGCTCCAAAGAACGCTCCTCTCAGAAACAGCGCAGCCGAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link