acvr2b

Ensembl ID:
ENSDARG00000044422
ZFIN IDs:
ZDB-GENE-980526-549, ZDB-GENE-980526-549
Description:
activin receptor type-2B [Source:RefSeq peptide;Acc:NP_571285]
Human Orthologue:
ACVR2B
Human Description:
activin A receptor, type IIB [Source:HGNC Symbol;Acc:174]
Mouse Orthologue:
Acvr2b
Mouse Description:
activin receptor IIB Gene [Source:MGI Symbol;Acc:MGI:87912]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3285 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019975 Essential Splice Site 205 493 6 13
ENSDART00000121592 Essential Splice Site 205 493 6 14
Genomic Location:
Chromosome 24 (position 42919679)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RCTAACYTAAGTCAACTCATCTCTGTGTGTGTGTGTGTNNNNNNNNTACTGTGTGTTC[A/C]GGATAAGCTGTCRTGGCAGAACGAGCGGGAGATGTTTTCCACTCCGGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n592r4rs