si:ch73-167c12.2

Ensembl ID:
ENSDARG00000044418
ZFIN ID:
ZDB-GENE-100922-268
Description:
LOC553421 protein [Source:UniProtKB/TrEMBL;Acc:Q504G8]
Human Orthologue:
CIR1
Human Description:
corepressor interacting with RBPJ, 1 [Source:HGNC Symbol;Acc:24217]
Mouse Orthologue:
Cir1
Mouse Description:
corepressor interacting with RBPJ, 1 Gene [Source:MGI Symbol;Acc:MGI:1914185]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18936 Nonsense Mutation detected in F1 DNA During 2017
sa10907 Nonsense Available for shipment Available now
sa27323 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065232 Nonsense 19 159 1 7
ENSDART00000146912 Nonsense 19 25 1 1
ENSDART00000065232 Nonsense 19 159 1 7
ENSDART00000146912 Nonsense 19 25 1 1
Genomic Location (Zv9):
Chromosome 9 (position 2462488)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2524130
KASP Assay ID:
2260-1385.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAATCTTTTGCTAATTTCATGTGTAAGAAGGATTTCCATCCTGCATCA[A/T]AATCCAACATAAAGAAGGTGAGAGGGTTTAAGCTAGCATGCTAATACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065232 Nonsense 19 159 1 7
ENSDART00000146912 Nonsense 19 25 1 1
ENSDART00000065232 Nonsense 19 159 1 7
ENSDART00000146912 Nonsense 19 25 1 1
Genomic Location (Zv9):
Chromosome 9 (position 2462488)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2524130
KASP Assay ID:
2260-1385.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAATCTTTTGCTAATTTCATGTGTAAGAAGGATTTCCATCCTGCATCA[A/T]AAWCCAACATAAAGAAGGTGAGAGGGTTTAAGCTAGCATGCTAATACGSC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065232 Essential Splice Site 86 159 5 7
ENSDART00000146912   None 25 None 1
Genomic Location (Zv9):
Chromosome 9 (position 2457329)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2529199
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTAACATGACTTTTTATGCTCTTTTGTTGTTGTTGTTGTTCATCTTCTT[A/G]GGGAGGAGAGTCAGAGTACAAGTTTGAGTGGCAGAAAGTGGCTCCTCGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link